Figure 1.

RT-PCR of ACC-1 and ACC-2 in Mouse Brain and Liver. ACC-2 expression levels were much higher in mouse brain as compared to ACC-1, whereas in liver, both ACC-1 and ACC-2 isoforms are expressed robustly. RT-PCR reaction was performed according to the procedures of Invitrogen, Inc. The reaction contained 0.5 μg of mouse brain or liver poly A⁺ RNA (Clontech Inc.) and remaining components in quantities according to the manufacturer's procedure in a total volume of 50 μL. For ACC-1, the sense primer (cgaaagactcttaactctgg) and anti-sense primer (ccaggttactgatctcatct) were used. For ACC-2, the sense primer (ggaagatgacagactcgaag) and anti-sense primer (tcatcagaggagttgtcatc) were used. Lane 1: low Mw marker. Lanes 2,4,6,7,9 and 11: empty. Lanes 3 and 5: brain poly A⁺ RNA, RT-PCR products. Lanes 8 and 10: liver poly A⁺ RNA, RT-PCR products. The expected product sizes were confirmed referring back to the full-length cDNA.